Mujtaba Zafar 10/15/14 Michael Hadjiargyrou Bio 440 Answers only: Alignment statistics for match #1 Score Expect Identities Gaps Strand 385 bits(208) 2e-103 229/238(96%) 5/238(2%) Plus/Plus Query 1 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAGAAAAAGAGTTTCCAGGAACTAGAAG 60 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 2774 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAG-AAAAGAGTTTCCAGGAACTAGAAG 2832 Query 61 ATGATTTAG
Premium DNA Gene RNA
Discuss 3 ways in which creolization has impacted the development of Caribbean art forms. Creolization is the coming together of new-comers and cultural strangers in a subordinate society. Creolization has highly influenced the development of Caribbean Art form in quite a few ways; Caribbean literature‚ fashion and music‚ all due to the colonial experience. Creolisation has played a major role in the evolution of music into several subgenres and fusions. Calypso is a style of Afro-Caribbean music that
Free Slavery Caribbean Calypso music
Coke’s European Scare Nishtha Vyas (80) Question 1. What are the management issues in this case? Answer- The major issue faced by coke was wrong and late anticipation of a problem that led to disastrous consequences. Also‚ the company’s hard earned goodwill was at stake due to poor communication and a lax approach in dealing with an issue of high priority. Coke faced serious issues inside the organization which was the lapse in quality control that contaminated the CO2 content. Coke’s myopic
Premium Public relations Communication Quality control
Jeff Jordan has made two theories revolving rights of same-sex marriage. They are called the parity and difference thesis. The parity thesis supports same-sex marriages‚ and the difference thesis opposes it. He has made assumptions that makes him believe it is acceptable to discriminate against homosexuals because of their sexuality. In means of the parity thesis‚ we should only discriminate homosexual behavior if it is done in public. His entire focus on the claim that homosexual behavior is only
Premium Homosexuality Same-sex marriage Marriage
Electric 1. Why do you think GE invested so aggressively in foreign expansion? Because GE tries to achieve its main goal: To be number 1 or 2 globally in every business in which it participates. Nowadays GE is not just an American company doing business abroad‚ but it had become a true global company. The revenues from international sales are growing significantly. This expansion is being powered by growing economies of Asia (particularly China and India). GE can achieve its goal through:
Premium Ethics Globalization
When conducting an interview for the American Film Institute‚ actor Jeff Bridges‚ discussing 1941’s Citizen Kane‚ said its director was "twenty-five years old‚ and he didn’t know what he couldn’t do...and Greg Toland gave him all the confidence in the world (2011‚ 0:28 sec.). Bridges was of course talking about the late‚ great Orson Welles. But who was Greg Toland? Well known in Hollywood at the time‚ Toland was a longtime cinematographer who had not only won an Academy Award for 1939’s Wuthering
Premium Orson Welles Citizen Kane Film
Advantage of Reading There are so many ways reading is an advantage to your learning. People read so they can improve on their vocabulary by reading words that they don’t know‚ and using the dictionary they will know what the word means. Reason why reading is an advantage is that it gives you a glimpse into other cultures and places in the world. While reading like “National Geographic” it gives you an insight on other people lifestyles‚ customs and their ethnicity of their people. It also
Premium United Kingdom English language Word
One sign that participation has declined in the UK is falling voter turnout. In 1979 76% of the electorate turned out to vote‚ whereas in 2001 it declined to 59.4%‚ recovering only slightly to 65.2% in 2010. Voting is an important form of political participation because it is the direct involvement of citizens in the selection of their political leaders. It’s decline is an important indicator of a fall in participation. A second indicator of falling participation is levels of party membership
Premium Political party Voting Conservatism
Jeff Nichol’s film Mud (2012) is a coming of age story about a young boy named Ellis whose idea of love and trust are challenged by those closest to him. A man named Mud becomes a friend and guide for Ellis‚ but also Ellis’ last hope for the existence of true and trustworthy love. Love is common theme throughout the film‚ but is especially important in the sequence of scenes near the end of the film that show the relationship between Ellis and his “girlfriend” and Ellis and Mud. The camerawork throughout
Premium Love Low-angle shot Interpersonal relationship
October 9‚ 2012 Essay #2: “In what ways are women objectified and what are the consequences?” On any street corner or at the turn of a page there are advertisements showing men‚ women and children for various products. Whether it is trying to sell a simple beauty product or lingerie using a scantily clad model‚ the images depicted somehow catch your attention. But have we ever stopped to think what that ad is really trying to accomplish? While evaluating that photo‚ has it ever made you feel somewhat
Premium Cosmetics