Chapter 10 and 11– Homework 1. Describe the stages of transcription. A. Begins when RNA polymerase binds to promoter B. RNA polymerase moves along DNA‚ adding complimentary ribonucleotides‚ until the end of the gene is reached C. RNA polymerase can only add to the 3’ end D. Transcription occurs in the 5’ to 3’ direction E. An RNA transcript is the end result F. All three types of RNA are transcribed from DNA Name 3 classes of RNA and their function. Ribosomal RNA‚ which is the site
Premium DNA Gene Evolution
What is being done to contain its spread? What treatments are available? Ebola genome is a single-stranded RNA approximately 19‚000 nucleotides long. It encodes seven structural proteins such as nucleoprotein‚ polymerase cofactor‚ transcription activator‚ RNA- dependent RNA polymerase. The Ebola virus is a Filovirus. These virus types cause fever or cause bleeding inside and outside the body when having a very high fever. Ebola can be further divided into subtypes that are named for
Premium Virus Cell Infection
Medical Assisting & the Ever Changing Medical Field Thomas Edison once said “The doctor of the future will give no medicine but will interest his patients in the care of the human frame‚ in diet and in the cause and prevention of disease.” The Medical field as a whole is rapidly growing and changing on a daily basis due to new laws and research being conducted. In my chosen profession‚ Medical Assistants are the key to the relationship between the doctors and the patients. The basic job skills
Premium Medical assistant Barack Obama Medicine
Ashley Mita Dr. Jator APSU 1000 26 November 2012 Personal Career Analysis: Medical Technologists Medical and clinical laboratory technologists and technicians run a number of different tests on cells‚ tissues‚ and fluids. They specialize in matching blood types‚ analyzing drug concentration in a patient ’s blood‚ finding parasites‚ bacteria‚ and viruses. They use an assortment of instruments and tools to perform these tests‚ which include: microscopes‚ automated equipment‚ cell counters‚ and
Premium Medicine Medical technology
1. The Right Rev. Michael T. Squires led the invocation at the graduation ceremony for Greenlee County’s first paramedic class. 2. Nanci Holloway‚ a 38-year-old Caucasian female‚ is scheduled for a cesarean section tomorrow. 3. The internist wanted him to have meprobamate‚ so he wrote a prescription for Miltown. 4. Johnny Temple had chickenpox‚ red measles‚ and German measles his first year in school. 5. I understand that Bob‚ our p.m. shift MT‚ is proficient in American Sign Language
Premium Cancer Hypertension Measles
Process of RNA synthesis 15. Carrier of amino acids for protein synthesis 16. A subunit of ribosomes 17. A set of rules used by cells to make proteins 18. A post transcriptional processing common to Eukaryotic cells a. rRNA b. tRNA c. Transcription d. Splicing e. Genetic code
Premium DNA Gene RNA
Mujtaba Zafar 10/15/14 Michael Hadjiargyrou Bio 440 Answers only: Alignment statistics for match #1 Score Expect Identities Gaps Strand 385 bits(208) 2e-103 229/238(96%) 5/238(2%) Plus/Plus Query 1 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAGAAAAAGAGTTTCCAGGAACTAGAAG 60 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 2774 AGTTATCATGGCCTCCCAAACCACTCACAAAGAAG-AAAAGAGTTTCCAGGAACTAGAAG 2832 Query 61 ATGATTTAG
Premium DNA Gene RNA
Transcript one: Me: Yoo wagone Fats‚ you aight? Fats: Yeye‚ you? Where’s Fabz? Me: Oh erm nah I dunno where she’s at man‚ I think she stayed at home instead yanoe Fats: Oh is it? (2) Maan! Me: Trust her to not come into school you know‚ aah man Fats: Just watch when she gets to school tomorrow. Gonna make sure she’s sorry. Thanz: (Enters) Hellooo babesh‚ youse lot aight… Me: … (Cuts through) heyoo “BABESH” lawls Thanz: allow me doe‚ oh yeah err where’s flabzilla at
Premium Formal Question Language
Studying Spoken Language Unit 4 Lesson 1: Introduction to studying spoken language OBJ: to gain an overview of the unit and begin to understand how to study spoken language Starter: Using PPT‚ explain the outline of the unit. Students to write the three areas down in their books. Development: ‘Let’s start with you’ activity on PPT. Students write down the definition of ‘idiolect’. Write down two ideas for each ‘bubble’; each factor that can change their idiolect. Share with
Premium Transcription Writing The Unit
The lipase gene sequence from Alcaligenes sp. JG3 was translated into amino acid sequence using two methods‚ manual translation and ExPASy online software. By manual method‚ amino acid sequence was obtained via codon translation one by one as shown in Figure IV.7. The sequence reference used is the lipase from A. faecalis MOR02 due to having high similarity with the lipase sequence from strain JG3 during CLUSTAL alignment and the alignment of the deduced amino acid with the referred sequence was
Premium Enzyme Glucose Gene