Conclusion 3211 Describe How The DNA
Conclusion 3.2.1
1 Describe how the DNA code is translated into messenger RNA.
DNA is translated into messenger RNA through transcription and translation. DNA is split through transcription and then it is translated to match into RNA.
2 How is the RNA molecule a “script” for the protein production process?
RNA is a script for the protein production process because they set the RNA up to translate into a protein.
3 What is the function of hemoglobin in the body?
Hemoglobin functions in the body by giving oxygen to the blood.
Conclusion 3.2.2
4 Describe (in words) the effect of the mutation.
If only one base is affected, it is called a point mutation. This results from substitution. When segments are added or deleted, this is called a frame shift mutation.
5 Was the mutational effect greater in a substitution or a deletion? Explain your answer clearly.
A mutational effect is greater in deletion because it affects the strand as a whole. However, with substitution, only one codon is affected.
6 Why do you think scientists call a substitution a “point mutation”? Why do you think scientists call a deletion (or an insertion) a “frameshift mutation”?
A point mutation comes from substitution because it is only changed one codon. However, when codons are deleted or inserted, it changes the bases as a whole, called a frame shift mutation.
7 Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the 15th base was changed from a G to a T. Fill in the corresponding mRNA, tRNA, and letter in the blanks below for the mutated DNA strip. In the space below, explain how this point mutation changes the protein.
Normal DNA:
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
mRNA:
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUU UUAACC tRNA: GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
Sentence:
SHE READS A LOT
Mutated DNA:
GTTGGCGAATGAACCTCGAGGCTGACGTCTAAGCCTAGAAAAATTGG
mRNA:
CAACCGCUUACUUGGAGCUCCGACUGCAGAUUCGGAUCUUU UUAACC
1 Describe how the DNA code is translated into messenger RNA.
DNA is translated into messenger RNA through transcription and translation. DNA is split through transcription and then it is translated to match into RNA.
2 How is the RNA molecule a “script” for the protein production process?
RNA is a script for the protein production process because they set the RNA up to translate into a protein.
3 What is the function of hemoglobin in the body?
Hemoglobin functions in the body by giving oxygen to the blood.
Conclusion 3.2.2
4 Describe (in words) the effect of the mutation.
If only one base is affected, it is called a point mutation. This results from substitution. When segments are added or deleted, this is called a frame shift mutation.
5 Was the mutational effect greater in a substitution or a deletion? Explain your answer clearly.
A mutational effect is greater in deletion because it affects the strand as a whole. However, with substitution, only one codon is affected.
6 Why do you think scientists call a substitution a “point mutation”? Why do you think scientists call a deletion (or an insertion) a “frameshift mutation”?
A point mutation comes from substitution because it is only changed one codon. However, when codons are deleted or inserted, it changes the bases as a whole, called a frame shift mutation.
7 Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the 15th base was changed from a G to a T. Fill in the corresponding mRNA, tRNA, and letter in the blanks below for the mutated DNA strip. In the space below, explain how this point mutation changes the protein.
Normal DNA:
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
mRNA:
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUU UUAACC tRNA: GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
Sentence:
SHE READS A LOT
Mutated DNA:
GTTGGCGAATGAACCTCGAGGCTGACGTCTAAGCCTAGAAAAATTGG
mRNA:
CAACCGCUUACUUGGAGCUCCGACUGCAGAUUCGGAUCUUU UUAACC