Molecular biology

Trevor Smith
Biol 4400
Dr. Achberger
May 8, 2013
a. From the amino acid sequence the gene is the LacI repressor for Escherichia coli. See appendix 1 for the search result.
b. The complete nucleic acid sequence of the protein with the open reading frame (ORF) indicated by red and green colorization as well as the forward and reverse primers underlined (a screenshot was taken so the sequence could be clearly displayed):

c. The ORF and flanking nucleotide sequences are displayed in part “b.” See appendix 2 for Ecocyc search result.
d. The primers chosen for the cloning of the gene are given below and underlined on the nucleic acid sequence in section “b”:
Forward: CCGGAAGAGA GTCAATTCAG GGTGGTG
Reverse: CACTCATTAG GCACCCCAGG
i. The vector system chosen for the gene is the pBAD/HIS vector. See appendix 3 for an image of this vector. The chosen primers with the attached restriction site are sequences (in bold) are:
Forward: (XhoI) GGGCTCGAG CCGGAAGAGA GTCAATTCAG GGTGGTG
Reverse: (Bgl II) GGGAGATCT CACTCATTAG GCACCCCAGG ii. The primers chosen follow the rules of primer design. First, the primers are both within the allowed nucleotide range of 18-28 nucleotides. The first primer is 27 nucleotides in length and the other is 20 nucleotides long. The GC content is within the allowed 50-60% range, forward being 55.6% GC and the reverse being 60% GC. The melting temperature (Tm) of the forward primer is 62.7 ºC and the Tm of the reverse is 55.9 ºC. The primers match in terms of having a GC content of ­± 5% and Tm’s ± 10 ºC of one another. Lastly, the primers are unique to the target sequence in E. coli as determined by the BLASTn database. Refer to appendix 4 and 5 to view the primer uniqueness results. The restriction sites that were used to clone the PCR fragment were XhoI and Bgl II. These sites do not occur within the target sequence and therefore are able to be used for this reaction. Refer to appendix 6 to view the results that confirm this. iii. An image of the pBad/His vector system can be found in appendix 3. The features included in this system include a translational initiation ATG site. A 6xHis that is a polyhistidine tag used for purification recombinant proteins expressed E. coli. An Xpress Epitope that permits detection of recombinant fusion proteins via appropriate antibodies. An EK site that is an abbreviation of enterokinase cleavage site which allows removal of the N-terminal peptide by enterokinase for production of native protein. An MCS which is an abbreviation for multiple cloning sites that encompass the insertions for the genes to be expressed. The araC gene that encodes the regulatory protein for tight regulation of the pBad promoter. A pBR322 origin that allows for low copy replication. And an ampicillin resistance gene that allows for selection of E. coli expressing the plasmid.
e. A set of primers that can be used to identify the LacI repressor for E. coli in a mixture of DNA including other organisms are as follows:
Forward: TTCCAGTCGGGAAACCTGTC
Reverse: GTTGGTGCGGATATCTCGGT Referring to appendix 7 the report indicates the primers are unique and will not cause any misamplification of undesired organisms or sequences. These primers abide by the primer rules as previously mentioned. The Tm forward is 59.6 ºC and Tm reverse is 59.9 ºC. They both have a 55% GC content, are 20 nucleotides in length, and match one another in terms of having the same GC content and Tm’s  10 ºC. Appendix 8 shows a screenshot of the primer pair from the website recorded under the 8th journal entry.
f. The protein that is encoded by the given amino acid sequence is the LacI repressor protein of the lactose operon in E. coli. This protein is a tetramer that binds to operators in the absence of lactose preventing RNA polymerase from transcribing the functional components of the lac operon that normally metabolize lactose. The lactose repressor is a fundamental component in catabolite repression because it allows for the lac operon to remain “off” so that the cell does not waste energy transcribing the proteins that catabolize lactose when there is a better substrate available such as glucose. When lactose is present, the lac operon is derepressed by the small effector molecule allolactose that binds to LacI and causes it to release from the operators.

Journal
1. Website used to determine amino acid sequence: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Web&LAYOUT=TwoWindows&AUTO_FORMAT=Semiauto&PAGE=Proteins&NCBI_GI=yes&HITLIST_SIZE=100&COMPOSITION_BASED_STATISTICS=yes&SHOW_OVERVIEW=yes&AUTO_FORMAT=yes&CDD_SEARCH=yes&FILTER=L&SHOW_LINKOUT=yes 2. Website used to determine the nucleic acid sequence: http://www.ncbi.nlm.nih.gov/nuccore/NC_007779.1?report=genbank&from=365652&to=366734&strand=true 3. Website used to determine ORF: http://ecocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10525 4. The vector system used was found on this website: http://products.invitrogen.com/ivgn/product/V43001 5. The uniqueness of the cloning primers was found using BLASTn: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Web&LAYOUT=TwoWindows&AUTO_FORMAT=Semiauto&PAGE=Nucleotides&NCBI_GI=yes&FILTER=L&HITLIST_SIZE=100&SHOW_OVERVIEW=yes&AUTO_FORMAT=yes 6. Checking to confirm that the restriction sites chosen did not occur within the DNA sequence was completed by this website: http://tools.neb.com/NEBcutter2 7. Details of the chosen vector found here: http://tools.invitrogen.com/content/sfs/manuals/pbad_man.pdf 8. The second set of primers was found using this primer BLAST search: http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?ORGANISM=316407&INPUT_SEQUENCE=NC_007779.1&LINK_LOC=nuccore&PRIMER5_START=365652&PRIMER3_END=366734 9. Information about the LacI repressor was obtained from this website: http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10525&redirect=T Appendices
Appendix 1: Feedback report of protein recognition

Appendix 2: Screenshot from Ecocyc of ORF

Appendix 3: Vector system used

Appendix 4: Forward cloning primer uniqueness

Appendix 5: Reverse cloning primer uniqueness

Appendix 6: Restriction site compatibility with the LacI protein sequence

Appendix 7: Gene detection primer uniqueness report

Appendix 8: A screenshot of the primer pairs for gene detection