Uromodulin Gene Mutation Case Study
Abstract: Objective: the aim of this study was to assess the influence of Uromodulin gene mutation on minerals and nitrogenous wastes levels in patients under hemodialysis patients. Methodology: One hundred patients with renal failure and under hemodialysis were investigated. Genetic analysis of Uromodulin gene mutation, as well as, minerals and nitrogenous waste were analyzed. Results: Of the 100 patients, 9 were detected with Uromodulin gene mutation. Conclusion: Patients with renal failure have more potentiality for deteriorated Minerals and nitrogenous wastes than others. Keywords: CKD, KSA, renal failure, Uromodulin gene.
Introduction
Chronic kidney disease (CKD), is progressive loss in kidney function over a period of time may be …show more content…
The obtained supernatant was discarded and white or pale red precipitate was collected. Thereafter, 200ul digestion buffer (DS) was added, vortex to form completely uniform suspension, then for the removal of RNA, 4 ul RNAse was added, vortex 5 second and incubated at RT 5 minutes. Thereafter, 20ul protinase Kand 220ul lysate (MS0 was added. vortex and incubated in water bath at 65 C for 15 minutes, then 220ul ethanol was added, upside -down mixed until flocculent precipitate occurred. A brief centrifugation to remove the inner wall of the tube cap drops, and solution was transferred to purification column. Centrifuged at 12.000 rpm for 1 minute, and discarded the filtrate. Then 500 ul of protein solution PS was added, centrifuged at 12.000 rpm for 1 minute, discarded the filtrate. Then 500ul Rinse (PE) was added, centrifuged at 12.000 rpm for 1 minute, discarded the filtrate. Then, 500ul Rinse PE was added, centrifuged at 12.000 rpm for 3 minutes, to completely remove the residual liquid purification column. Purification columns placed on a new 1.5 ml centrifuge tube, to the center, dropping 30-100ul eluent TE, incubated at Room Temperature (RT) for 2 minutes. Then centrifuged at 12.000 rpm for 2 …show more content…
Direct sequencing of amplification products is done in both forward (GAGCGGCTCAGAGAACTTCAGTGG) and reverse (CCCGTGTCCTGTGTTACATTCATC) directions (Primer Sequence (5´–3´), amplification (529 bp)), using PCR method. PCR amplification of the UMOD gene was performed as designated in Table 1and 2. The program used for amplification at the thermal cycler (Eppendorf - Master cycler) from (Beijing Aidlab Biotechnology Co.,
Introduction
Chronic kidney disease (CKD), is progressive loss in kidney function over a period of time may be …show more content…
The obtained supernatant was discarded and white or pale red precipitate was collected. Thereafter, 200ul digestion buffer (DS) was added, vortex to form completely uniform suspension, then for the removal of RNA, 4 ul RNAse was added, vortex 5 second and incubated at RT 5 minutes. Thereafter, 20ul protinase Kand 220ul lysate (MS0 was added. vortex and incubated in water bath at 65 C for 15 minutes, then 220ul ethanol was added, upside -down mixed until flocculent precipitate occurred. A brief centrifugation to remove the inner wall of the tube cap drops, and solution was transferred to purification column. Centrifuged at 12.000 rpm for 1 minute, and discarded the filtrate. Then 500 ul of protein solution PS was added, centrifuged at 12.000 rpm for 1 minute, discarded the filtrate. Then 500ul Rinse (PE) was added, centrifuged at 12.000 rpm for 1 minute, discarded the filtrate. Then, 500ul Rinse PE was added, centrifuged at 12.000 rpm for 3 minutes, to completely remove the residual liquid purification column. Purification columns placed on a new 1.5 ml centrifuge tube, to the center, dropping 30-100ul eluent TE, incubated at Room Temperature (RT) for 2 minutes. Then centrifuged at 12.000 rpm for 2 …show more content…
Direct sequencing of amplification products is done in both forward (GAGCGGCTCAGAGAACTTCAGTGG) and reverse (CCCGTGTCCTGTGTTACATTCATC) directions (Primer Sequence (5´–3´), amplification (529 bp)), using PCR method. PCR amplification of the UMOD gene was performed as designated in Table 1and 2. The program used for amplification at the thermal cycler (Eppendorf - Master cycler) from (Beijing Aidlab Biotechnology Co.,